Top » Catalog » SNPs » FGC2582

$18.00

FGC2582
[FGC2582]

FGC2582
hg38 Position: ChrY:14877002..14877002
Ancestral: A
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: FGC2582_F TTTCAGCTTCAAATGATGCAC
Reverse Primer: FGC2582_R CCATTTTAGCCATGCTGGTC
Reviews

Customers who bought this product also purchased
FGC2571
FGC2571
FGC2585
FGC2585
R1a-FGC2555 Hollister Panel
R1a-FGC2555 Hollister Panel
FGC2581
FGC2581
FGC2578
FGC2578
FGC2591
FGC2591
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies