Top » Catalog » SNPs » FGC2589

$18.00

FGC2589
[FGC2589]

FGC2589
hg38 Position: ChrY:17103862..17103862
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: FGC2589_F CCAGTTTCTTGTTTTGAGAAGTTATAGG
Reverse Primer: FGC2589_R ATCACCCCATGCTGGAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies