Top » Catalog » SNPs » FGC2589

$18.00

FGC2589
[FGC2589]

FGC2589
hg38 Position: ChrY:17103862..17103862
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: FGC2589_F CCAGTTTCTTGTTTTGAGAAGTTATAGG
Reverse Primer: FGC2589_R ATCACCCCATGCTGGAAG
Reviews

Customers who bought this product also purchased
FGC2574
FGC2574
FGC2590
FGC2590
FGC2573
FGC2573
FGC2585
FGC2585
FGC2571
FGC2571
FGC2582
FGC2582
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies