Top » Catalog » SNPs » FGC2590

$18.00

FGC2590
[FGC2590]

FGC2590
hg38 Position: ChrY:17299418..17299418
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: FGC2590_F ACCGAGGATATCTGGTGAGG
Reverse Primer: FGC2590_R TCTCTTTTGGAGGCCATACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y6511
1 x Y19107
$36.00
Haplogroup Info
Other products
Currencies