Top » Catalog » SNPs » FGC2591

$18.00

FGC2591
[FGC2591]

FGC2591
hg38 Position: ChrY:17336376..17336376
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: FGC2591_F AAGAATGGGCACATCAAACAC
Reverse Primer: FGC2591_R TGGTCAGCCTTCTCTCCATC
Reviews

Customers who bought this product also purchased
FGC2578
FGC2578
FGC2590
FGC2590
FGC2574
FGC2574
FGC2589
FGC2589
FGC2573
FGC2573
FGC2585
FGC2585
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies