Top » Catalog » SNPs » FGC2591

$18.00

FGC2591
[FGC2591]

FGC2591
hg38 Position: ChrY:17336376..17336376
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: FGC2591_F AAGAATGGGCACATCAAACAC
Reverse Primer: FGC2591_R TGGTCAGCCTTCTCTCCATC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies