Top » Catalog » SNPs » Y22931

$18.00

Y22931
[Y22931]

Y22931
hg38 Position: ChrY:22243844..22243844
Ancestral: G
Derived: C
Reference: YFull (2016)
ISOGG Haplogroup: T
Comments: .
Forward Primer: Y22931_F ATCAGGGTGATGCTGGTCTC
Reverse Primer: Y22931_R GTGAAACCCCACCCTCTACC
Reviews

Customers who bought this product also purchased
Z19867
Z19867
A18898
A18898
A19090
A19090
M8325
M8325
T-PF4074 Berger Panel
T-PF4074 Berger Panel
A19089
A19089
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies