Top » Catalog » SNPs » Y22931

$18.00

Y22931
[Y22931]

Y22931
hg38 Position: ChrY:22243844..22243844
Ancestral: G
Derived: C
Reference: YFull (2016)
ISOGG Haplogroup: T
Comments: .
Forward Primer: Y22931_F ATCAGGGTGATGCTGGTCTC
Reverse Primer: Y22931_R GTGAAACCCCACCCTCTACC
Reviews

Customers who bought this product also purchased
A19144
A19144
A18899
A18899
A19110
A19110
Z19867
Z19867
A18898
A18898
A19090
A19090
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies