Top » Catalog » SNPs » Y37001

$18.00

Y37001
[Y37001]

Y37001
hg38 Position: ChrY:12337802..12337802
Ancestral: G
Derived: A
Reference: Yfull (2017)
ISOGG Haplogroup: J2a
Comments: Approx. below F3133
Forward Primer: Y37001_F GTGGGGTTTTTTGTGAATGG
Reverse Primer: Y37001_R CCATCTACTTCAAAGCAAATATACATTG
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
BY25075
BY25075
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies