Top » Catalog » SNPs » Y37001

$18.00

Y37001
[Y37001]

Y37001
hg38 Position: ChrY:12337802..12337802
Ancestral: G
Derived: A
Reference: Yfull (2017)
ISOGG Haplogroup: J2a
Comments: Approx. below F3133
Forward Primer: Y37001_F GTGGGGTTTTTTGTGAATGG
Reverse Primer: Y37001_R CCATCTACTTCAAAGCAAATATACATTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies