Top » Catalog » SNPs » JFS3040

$18.00

JFS3040
[JFS3040]

JFS3040
hg38 Position: ChrY:13981607..13981607
Ancestral: C
Derived: T
Reference: John Sloan (2017)
ISOGG Haplogroup: R1b
Comments:
Forward Primer: JFS3040_F TCGAGAGCTCCCAATTAATTCATAG
Reverse Primer: JFS3040_R ATAAAATAATAGATATCAAAGCTTCCTGGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies