Top » Catalog » SNPs » A922

$18.00

A922
[A922]

A922
hg38 Position: ChrY:15914126..15914126
Ancestral: C
Derived: A
Reference: YSEQ (2014)
ISOGG Haplogroup: R1b1a2a1a2c1i1a (not listed)
Comments: Downstream S781
Forward Primer: A922_F TGCACACCCACAGAGAATTG
Reverse Primer: A922_R AAATGTCAGGTGGCAAGGTC
Reviews

Customers who bought this product also purchased
FGC74571
FGC74571
M2889
M2889
FGC74573
FGC74573
A921
A921
A5023
A5023
S310
S310
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1734
1 x A557
1 x A776
1 x A1077
1 x A291
1 x A391
1 x A91
1 x A1239
1 x A1500
1 x A2266
1 x A137
1 x A611
1 x A589
1 x A956
1 x A1335
1 x A88
1 x A1281
1 x A311
1 x A1312
1 x A774
$360.00
Haplogroup Info
Other products
Currencies