Top » Catalog » SNPs » A19334

$18.00

A19334
[A19334]

A19334
hg38 Position: ChrY:16035111..16035111
Ancestral: T
Derived: A
Reference: Ahmad Alroqi (2017)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A19334_F TGCTCCCAATTTCCTGACTC
Reverse Primer: A19334_R AATGAATCCTGGGGACACC
Reviews

Customers who bought this product also purchased
A19337
A19337
A19336
A19336
A19335
A19335
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies