Top » Catalog » SNPs » A19335

$18.00

A19335
[A19335]

A19335
hg38 Position: ChrY:17220841..17220841
Ancestral: T
Derived: C
Reference: Ahmad Alroqi (2017)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A19335_F TCCCCTGCATATGAGGTTTC
Reverse Primer: A19335_R GTGTAACTGCAGCCCTGAGC
Reviews

Customers who bought this product also purchased
A19334
A19334
A19337
A19337
A19336
A19336
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies