Top » Catalog » SNPs » A19335

$18.00

A19335
[A19335]

A19335
hg38 Position: ChrY:17220841..17220841
Ancestral: T
Derived: C
Reference: Ahmad Alroqi (2017)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A19335_F TCCCCTGCATATGAGGTTTC
Reverse Primer: A19335_R GTGTAACTGCAGCCCTGAGC
Reviews

Customers who bought this product also purchased
ZS5814
ZS5814
ZS11817
ZS11817
ZS5801
ZS5801
A13649
A13649
FGC1715
FGC1715
ZS11617
ZS11617
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies