Top » Catalog » SNPs » A19335

$18.00

A19335
[A19335]

A19335
hg38 Position: ChrY:17220841..17220841
Ancestral: T
Derived: C
Reference: Ahmad Alroqi (2017)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A19335_F TCCCCTGCATATGAGGTTTC
Reverse Primer: A19335_R GTGTAACTGCAGCCCTGAGC
Reviews

Customers who bought this product also purchased
FGC1715
FGC1715
ZS11617
ZS11617
FGC40709
FGC40709
FGC34530
FGC34530
FGC1713
FGC1713
ZS5809
ZS5809
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies