Top » Catalog » SNPs » A19349

$18.00

A19349
[A19349]

A19349
hg38 Position: ChrY:16482007..16482007
Ancestral: T
Derived: A
Reference: Petr Soucek (2017)
ISOGG Haplogroup: R1a
Comments:
Forward Primer: A19349_F AAAGGGACAGAATTCCAAAGC
Reverse Primer: A19349_R TTTCAACCAACTGCTCTCTCC
Reviews

Customers who bought this product also purchased
A19354
A19354
A19342
A19342
A19932
A19932
A19347
A19347
M12430
M12430
A19353
A19353
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies