Top » Catalog » SNPs » A19352

$18.00

A19352
[A19352]

A19352
hg38 Position: ChrY:16788475..16788475
Ancestral: A
Derived: G
Reference: Petr Soucek (2017)
ISOGG Haplogroup: R1a
Comments:
Forward Primer: A19352_F AATAAATGCCTGGGGTTTGC
Reverse Primer: A19352_R CCTTTGTGGGCTGTATCCAC
Reviews

Customers who bought this product also purchased
A19351
A19351
R1a-P278 Kristofoli Panel
R1a-P278 Kristofoli Panel
A19357
A19357
A19345
A19345
CTS10301
CTS10301
A19350
A19350
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies