Top » Catalog » SNPs » A19352

$18.00

A19352
[A19352]

A19352
hg38 Position: ChrY:16788475..16788475
Ancestral: A
Derived: G
Reference: Petr Soucek (2017)
ISOGG Haplogroup: R1a
Comments:
Forward Primer: A19352_F AATAAATGCCTGGGGTTTGC
Reverse Primer: A19352_R CCTTTGTGGGCTGTATCCAC
Reviews

Customers who bought this product also purchased
A19347
A19347
M12430
M12430
A19353
A19353
A19341
A19341
A19360
A19360
A19346
A19346
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies