Top » Catalog » SNPs » A19352

$18.00

A19352
[A19352]

A19352
hg38 Position: ChrY:16788475..16788475
Ancestral: A
Derived: G
Reference: Petr Soucek (2017)
ISOGG Haplogroup: R1a
Comments:
Forward Primer: A19352_F AATAAATGCCTGGGGTTTGC
Reverse Primer: A19352_R CCTTTGTGGGCTGTATCCAC
Reviews

Customers who bought this product also purchased
CTS10301
CTS10301
A19345
A19345
A20673
A20673
A19350
A19350
A19356
A19356
A19934
A19934
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies