Top » Catalog » SNPs » A19353

$18.00

A19353
[A19353]

A19353
hg38 Position: ChrY:17183639..17183639
Ancestral: G
Derived: A
Reference: Petr Soucek (2017)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: A19353v2_F TCACAAGGTCAGGAGTTTGAGAG
Reverse Primer: A19353v2_R CCTTGTCTTGATGCTATGATCTCA
Reviews

Customers who bought this product also purchased
R1a-P278 Kristofoli Panel
R1a-P278 Kristofoli Panel
A19357
A19357
CTS10301
CTS10301
A19345
A19345
A20673
A20673
A19350
A19350
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies