Top » Catalog » SNPs » A19356

$18.00

A19356
[A19356]

A19356
hg38 Position: ChrY:19152853..19152853
Ancestral: G
Derived: A
Reference: Petr Soucek (2017)
ISOGG Haplogroup: R1a
Comments:
Forward Primer: A19356_F AGTGATCCACCTGCCTCAAC
Reverse Primer: A19356_R TGCCAACATGTGATTTCTCC
Reviews

Customers who bought this product also purchased
A19354
A19354
A19343
A19343
A19933
A19933
A19348
A19348
M12450
M12450
A19353
A19353
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies