Top » Catalog » SNPs » A19356

$18.00

A19356
[A19356]

A19356
hg38 Position: ChrY:19152853..19152853
Ancestral: G
Derived: A
Reference: Petr Soucek (2017)
ISOGG Haplogroup: R1a
Comments:
Forward Primer: A19356_F AGTGATCCACCTGCCTCAAC
Reverse Primer: A19356_R TGCCAACATGTGATTTCTCC
Reviews

Customers who bought this product also purchased
A19346
A19346
M12429
M12429
A19351
A19351
R1a-P278 Kristofoli Panel
R1a-P278 Kristofoli Panel
A19357
A19357
A19345
A19345
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies