Top » Catalog » SNPs » A19384

$18.00

A19384
[A19384]

A19384
hg38 Position: ChrY:19577134..19577134
Ancestral: C
Derived: T
Reference: Zdenko Markovic (2017)
ISOGG Haplogroup: I2
Comments: Below L233
Forward Primer: A19384_F CTGCACATGTACCCCAGAAC
Reverse Primer: A19384_R TCCGTTCAGTCATCCCCTAC
Reviews

Customers who bought this product also purchased
A7111
A7111
Y33761
Y33761
L160
L160
CTS595
CTS595
A19485
A19485
A417
A417
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies