Top » Catalog » SNPs » ALK28

$18.00

ALK28
[ALK28]

ALK28
hg38 Position: ChrY:6967890..6967890
Ancestral: C
Derived: G
Reference: Ahmad Al Khuraiji (2017)
ISOGG Haplogroup: J1a
Comments: Below BY145
Forward Primer: ALK28_F TGTGAACCATGATGCCTAGC
Reverse Primer: ALK28_R AACAGGAGATGAGGGCACAG
Reviews

Customers who bought this product also purchased
FGC54383
FGC54383
ALK30
ALK30
ALK29
ALK29
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies