Top » Catalog » SNPs » A19455

$18.00

A19455
[A19455]

A19455
hg38 Position: ChrY:14624721..14624721
Ancestral: C
Derived: T
Reference: Zdenko Markovic (2017)
ISOGG Haplogroup: I2a
Comments: Below CTS1758 > Z27034
Forward Primer: A19455_F AGGGTGGACGTTTCATTGTG
Reverse Primer: A19455_R TGATGCCAACATTTCAGTAGG
Reviews

Customers who bought this product also purchased
CTS1758
CTS1758
BY130413
BY130413
Y23411
Y23411
Z105
Z105
Z27030
Z27030
Y24017
Y24017
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies