Top » Catalog » SNPs » V3262

$18.00

V3262
[V3262]

V3262
hg38 Position: ChrY:13834303..13834303
Ancestral: G
Derived: A
Reference: Trombetta et al (2015)
ISOGG Haplogroup: E
Comments: .
Forward Primer: V3262_F GGAGCCAGGATGAAATGAAC
Reverse Primer: V3262_R GCAGAGGTAGGCAGAAATGC
Reviews

Customers who bought this product also purchased
PH2818
PH2818
BY7729
BY7729
M215
M215
BY7669
BY7669
E Superclade Panel
E Superclade Panel
BY7446
BY7446
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies