Top » Catalog » SNPs » A19473

$18.00

A19473
[A19473]

A19473
hg38 Position: ChrY:21199727..21199727
Ancestral: G
Derived: T
Reference: John Orr (2017)
ISOGG Haplogroup: R1a
Comments:
Forward Primer: A19473_F TTGATAGTTTTGTTTGCTGCACAC
Reverse Primer: A19473_R TACAGTAACCACACAGCATCATG
Reviews

Customers who bought this product also purchased
A19467
A19467
A19472
A19472
A19471
A19471
A19470
A19470
A19469
A19469
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies