Top » Catalog » SNPs » A19479

$18.00

A19479
[A19479]

A19479
hg38 Position: ChrY:10660984..10660984
Ancestral: G
Derived: C
Reference: Zachary Daugherty (2017)
ISOGG Haplogroup: R1b
Comments:
Forward Primer: A19479_F CCATTGCATTCCAACAGAATC
Reverse Primer: A19479_R GGCGTGTAGTGGAGTGAAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies