Top » Catalog » SNPs » PH2263

$18.00

PH2263
[PH2263]

PH2263
hg38 Position: ChrY:14307082..14307082
Ancestral: C
Derived: T
Reference: Pille Hallast et al. (2014)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: PH2263_F CGTGCTGTCACTTTTGCTTC
Reverse Primer: PH2263_R AAATCTGTTTTGGCCAGGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies