Top » Catalog » SNPs » A19485

$18.00

A19485
[A19485]

A19485
hg38 Position: ChrY:21469694..21469694
Ancestral: A
Derived: G
Reference: Zdenko Markovic (2017)
ISOGG Haplogroup: I2
Comments: Below
Forward Primer: A19485_F TGAAAGAAGCCAAGCATTCC
Reverse Primer: A19485_R GAGGATCCACCTCAGCAATC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies