Top » Catalog » SNPs » A19485

$18.00

A19485
[A19485]

A19485
hg38 Position: ChrY:21469694..21469694
Ancestral: A
Derived: G
Reference: Zdenko Markovic (2017)
ISOGG Haplogroup: I2
Comments: Below
Forward Primer: A19485_F TGAAAGAAGCCAAGCATTCC
Reverse Primer: A19485_R GAGGATCCACCTCAGCAATC
Reviews

Customers who bought this product also purchased
M26
M26
A10033
A10033
Y33761
Y33761
CTS595
CTS595
Y4252
Y4252
A15076
A15076
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies