Top » Catalog » SNPs » A19485

$18.00

A19485
[A19485]

A19485
hg38 Position: ChrY:21469694..21469694
Ancestral: A
Derived: G
Reference: Zdenko Markovic (2017)
ISOGG Haplogroup: I2
Comments: Below
Forward Primer: A19485_F TGAAAGAAGCCAAGCATTCC
Reverse Primer: A19485_R GAGGATCCACCTCAGCAATC
Reviews

Customers who bought this product also purchased
Y4200
Y4200
FGC56815
FGC56815
A417
A417
L160
L160
A19384
A19384
A7111
A7111
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies