Top » Catalog » SNPs » A19485

$18.00

A19485
[A19485]

A19485
hg38 Position: ChrY:21469694..21469694
Ancestral: A
Derived: G
Reference: Zdenko Markovic (2017)
ISOGG Haplogroup: I2
Comments: Below L233
Forward Primer: A19485_F TGAAAGAAGCCAAGCATTCC
Reverse Primer: A19485_R GAGGATCCACCTCAGCAATC
Reviews

Customers who bought this product also purchased
I2 Superclade Panel
I2 Superclade Panel
S2679
S2679
M223
M223
Y54081
Y54081
Y138217
Y138217
A19385
A19385
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies