Top » Catalog » SNPs » A19488

$18.00

A19488
[A19488]

A19488
hg38 Position: ChrY:12815473..12815473
Ancestral: G
Derived: A
Reference: Zdenko Markovic (2017)
ISOGG Haplogroup: I2
Comments: Below PF4189
Forward Primer: A19488_F CCGAGTTCAAGCAGTTCTCC
Reverse Primer: A19488_R ACCCATGAGACAAAGGTTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies