Top » Catalog » SNPs » A19489

$18.00

A19489
[A19489]

A19489
hg38 Position: ChrY:17439062..17439062
Ancestral: T
Derived: C
Reference: Zdenko Markovic (2017)
ISOGG Haplogroup: I2
Comments: Below PF4189
Forward Primer: A19489_F CACAAGCCCTGTTATCTTGG
Reverse Primer: A19489_R GCATTTGCTTCTGTGTCCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies