Top » Catalog » SNPs » A19490

$18.00

A19490
[A19490]

A19490
hg38 Position: ChrY:19072355..19072355
Ancestral: A
Derived: G
Reference: Zdenko Markovic (2017)
ISOGG Haplogroup: I2
Comments: Below PF4189
Forward Primer: A19490_F ACCACAAGCAACCAGTTTCC
Reverse Primer: A19490_R ATGCTGTAAGGGATGGGTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies