Top » Catalog » SNPs » FGC71320

$18.00

FGC71320
[FGC71320]

FGC71320
hg38 Position: ChrY:21197083..21197083
Ancestral: T
Derived: G
Reference: Michael Lally (2017)
ISOGG Haplogroup: R1b
Comments:
Forward Primer: FGC71320_F GTTAATGGGTGCAGGAAACC
Reverse Primer: FGC71320_R GACTTACAGTCTCACATGGTCAGG
Reviews

Customers who bought this product also purchased
FGC71318
FGC71318
FGC71319
FGC71319
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies