Top » Catalog » SNPs » A19496

$18.00

A19496
[A19496]

A19496
hg38 Position: ChrY:17157149..17157149
Ancestral: C
Derived: T
Reference: Walker Ogden (2017)
ISOGG Haplogroup: R1b
Comments:
Forward Primer: A19496_F AGTTGCACAGGCATTCACAG
Reverse Primer: A19496_R GAGATGGGTTCTGGGGTAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies