Top » Catalog » SNPs » A19496

$18.00

A19496
[A19496]

A19496
hg38 Position: ChrY:17157149..17157149
Ancestral: C
Derived: T
Reference: Walker Ogden (2017)
ISOGG Haplogroup: R1b
Comments:
Forward Primer: A19496_F AGTTGCACAGGCATTCACAG
Reverse Primer: A19496_R GAGATGGGTTCTGGGGTAGG
Reviews

Customers who bought this product also purchased
A19495
A19495
A19494
A19494
A19493
A19493
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies