Top » Catalog » SNPs » A19501

$18.00

A19501
[A19501]

A19501
hg38 Position: ChrY:12199363..12199363
Ancestral: T
Derived: A
Reference: Ed Aber Leek (2017)
ISOGG Haplogroup: R1b
Comments: Below BY21586
Forward Primer: A19501_F AGGAAGGGCTGCATGTTAAG
Reverse Primer: A19501_R TGGAAGGGGAAACTCTGATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies