Top » Catalog » SNPs » A19501

$18.00

A19501
[A19501]

A19501
hg38 Position: ChrY:12199363..12199363
Ancestral: T
Derived: A
Reference: Ed Aber Leek (2017)
ISOGG Haplogroup: R1b
Comments: Below BY21586
Forward Primer: A19501_F AGGAAGGGCTGCATGTTAAG
Reverse Primer: A19501_R TGGAAGGGGAAACTCTGATG
Reviews

Customers who bought this product also purchased
A19498
A19498
A19504
A19504
A19503
A19503
A19502
A19502
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies