Top » Catalog » SNPs » A19502

$18.00

A19502
[A19502]

A19502
hg38 Position: ChrY:16278608..16278608
Ancestral: C
Derived: T
Reference: Ed Aber Leek (2017)
ISOGG Haplogroup: R1b
Comments: Below BY21586
Forward Primer: A19502_F GATCTGTGATTTCTTGCCAGTG
Reverse Primer: A19502_R GCAGCAAAGCATCCAAATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies