Top » Catalog » SNPs » A19502

$18.00

A19502
[A19502]

A19502
hg38 Position: ChrY:16278608..16278608
Ancestral: C
Derived: T
Reference: Ed Aber Leek (2017)
ISOGG Haplogroup: R1b
Comments: Below BY21586
Forward Primer: A19502_F GATCTGTGATTTCTTGCCAGTG
Reverse Primer: A19502_R GCAGCAAAGCATCCAAATG
Reviews

Customers who bought this product also purchased
A19503
A19503
A19501
A19501
A19498
A19498
A19504
A19504
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x DYS437
$9.95
Haplogroup Info
Other products
Currencies