Top » Catalog » SNPs » Y28673

$18.00

Y28673
[Y28673]

Y28673
hg38 Position: ChrY:6784534..6784534
Ancestral: C
Derived: T
Reference: YFull (2016)
ISOGG Haplogroup: unknown
Comments: .
Forward Primer: Y28673_F GACTGCCATCCTCACAGATG
Reverse Primer: Y28673_R TGGCTGCAGGTCATTACAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies