Top » Catalog » SNPs » A19505

$18.00

A19505
[A19505]

A19505
hg38 Position: ChrY:12836964..12836964
Ancestral: C
Derived: T
Reference: Ben Van Beurden (2017)
ISOGG Haplogroup: G2a
Comments: .
Forward Primer: A19505_F GTTCTGTCTCCCAGACACTCG
Reverse Primer: A19505_R GGGTCAAGTGATCCTTCTGC
Reviews

Customers who bought this product also purchased
A19508
A19508
A19507
A19507
A19506
A19506
Z7014
Z7014
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies