Top » Catalog » SNPs » A19506

$18.00

A19506
[A19506]

A19506
hg38 Position: ChrY:13759817..13759817
Ancestral: C
Derived: T
Reference: Ben Van Beurden (2017)
ISOGG Haplogroup: G2a
Comments: .
Forward Primer: A19506_F TGCCTCTCACATTCAAGCAG
Reverse Primer: A19506_R GCAACATGGTGAAACCCAGTAC
Reviews

Customers who bought this product also purchased
A19505
A19505
Z7014
Z7014
A19508
A19508
A19507
A19507
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies