Top » Catalog » SNPs » A19507

$18.00

A19507
[A19507]

A19507
hg38 Position: ChrY:15764556..15764556
Ancestral: G
Derived: A
Reference: Ben Van Beurden (2017)
ISOGG Haplogroup: G2a
Comments: .
Forward Primer: A19507_F TACCCACCACCATGCCCC
Reverse Primer: A19507_R TGGGGAGTTAAGGAAGGAGAG
Reviews

Customers who bought this product also purchased
A19505
A19505
Z7014
Z7014
A19508
A19508
A19506
A19506
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies