Top » Catalog » SNPs » Z17299

$18.00

Z17299
[Z17299]

Z17299
hg38 Position: ChrY:14138955..14138955
Ancestral: G
Derived: T
Reference: G. Magoon et al.
ISOGG Haplogroup: R1b1a1a2a1a2c1b1b1a1a1
Comments: downstream of L513>L193
Forward Primer: Z17299_F AAGGGTTTTCTTGTGTTACAACG
Reverse Primer: Z17299_R CCTGGCACATAATAAGGCTTG
Reviews

Customers who bought this product also purchased
Z253
Z253
FGC32805
FGC32805
DF49
DF49
Z17816
Z17816
Z39589
Z39589
Z16340
Z16340
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies