Top » Catalog » SNPs » Y11818

$18.00

Y11818
[Y11818]

Y11818
hg38 Position: ChrY:18986595..18986595
Ancestral: T
Derived: A
Reference: Yfull (2015)
ISOGG Haplogroup: R-YP1337
Comments: .
Forward Primer: Y11818_F GGTATAGTGGCTTATGCTTGTAATATAGC
Reverse Primer: Y11818_R GGTCTCAGTCCAGGCTCG
Reviews

Customers who bought this product also purchased
A19128
A19128
YSEQ-XTD
YSEQ-XTD
DYS684
DYS684
A19124
A19124
R1a-YP1341 Cepela Panel
R1a-YP1341 Cepela Panel
DYS614
DYS614
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies