Top » Catalog » SNPs » Y11818

$18.00

Y11818
[Y11818]

Y11818
hg38 Position: ChrY:18986595..18986595
Ancestral: T
Derived: A
Reference: Yfull (2015)
ISOGG Haplogroup: R-YP1337
Comments: .
Forward Primer: Y11818_F GGTATAGTGGCTTATGCTTGTAATATAGC
Reverse Primer: Y11818_R GGTCTCAGTCCAGGCTCG
Reviews

Customers who bought this product also purchased
A19309
A19309
DYF371X
DYF371X
DYF399X
DYF399X
A19134
A19134
FTDNA111 to YSEQ116
FTDNA111 to YSEQ116
DYS464X
DYS464X
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies