Top » Catalog » SNPs » A19610

$18.00

A19610
[A19610]

A19610
hg38 Position: ChrY:12330169..12330169
Ancestral: T
Derived: G
Reference: Gary Blakely (2017)
ISOGG Haplogroup: R1b
Comments: Below P89.2
Forward Primer: A19610_F ACCATTAAGGCACACACCTG
Reverse Primer: A19610_R GCAGGAAGCAGTTTCTGAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies