Top » Catalog » SNPs » A19616

$18.00

A19616
[A19616]

A19616
hg38 Position: ChrY:20519576..20519576
Ancestral: C
Derived: T
Reference: Gary Blakely (2017)
ISOGG Haplogroup: R1b
Comments: Below P89.2
Forward Primer: A19616_F AAAATGTCCACTGCAGAATGC
Reverse Primer: A19616_R GGGCATTAGAAATGGGACTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies